About   Help   FAQ
Due to maintenance, access to MGI may be intermittent 7:30-8:30 AM EDT Thursday, May 28.
D1Mit205 Primer Detail
Primers
  • Name
    D1Mit205
  • Primer 1 Sequence
    AGTCTTTATCAGGCAAGGAAACC
  • Primer 2 Sequence
    CACAGCAAGGTGGCTGACT
  • ID
    MGI:701352
  • Product Size
    147
  • Other IDs
    128545 (NCBI UniSTS)
    D1Mit205 (BROAD)
  • Note
    MIT assay: MMH289
Genes
D1Mit205 DNA segment, Chr 1, Massachusetts Institute of Technology 205
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit205 a 147bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J
b 151bp CAST/EiJ, NOD/MrkTac
c 157bp C3H/HeJ, LP/J
d 159bp A/J, NON/ShiLt, SPRET/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/19/2020
MGI 6.15
The Jackson Laboratory