About   Help   FAQ
D19Mit27 Primer Detail
Primers
  • Name
    D19Mit27
  • Primer 1 Sequence
    CAGCCTCCTGAAAACTCAGG
  • Primer 2 Sequence
    GTGGTTGAAGGAAAAGTTGAGG
  • ID
    MGI:701324
  • Product Size
    175
  • Other IDs
    128367 (NCBI UniSTS)
    D19Mit27 (BROAD)
  • Note
    MIT assay: B573
Genes
D19Mit27 DNA segment, Chr 19, Massachusetts Institute of Technology 27
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit27 m 253bp MOLF/EiJ
s 234bp 129/Sv
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory