About   Help   FAQ
D6Mit8.1 Primer Detail
Primers
  • Name
    D6Mit8.1
  • Primer 1 Sequence
    GCACAAGGGATGCCTTAGAG
  • Primer 2 Sequence
    TGTGCAAAGCCAGCAGTTTA
  • ID
    MGI:701130
  • Product Size
    222
  • Other IDs
    130982 (NCBI UniSTS)
    D6Mit8.1 (BROAD)
  • Note
    MIT assay: D6Mit8.1
Genes
D6Mit8.1 DNA segment, Chr 6, Massachusetts Institute of Technology 8.1
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit8.1 a 164bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
b 170bp AKR/J
c 178bp LP/J
d 180bp CAST/EiJ
e 182bp SPRET/EiJ
f 188bp NOD/MrkTac
g 190bp A/J, BALB/cJ, NON/ShiLt
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/13/2021
MGI 6.16
The Jackson Laboratory