About   Help   FAQ
D9Mit342 Primer Detail
Primers
  • Name
    D9Mit342
  • Primer 1 Sequence
    TTGGGCTGGGTCACAGTT
  • Primer 2 Sequence
    TGGAATTATCCAGGGGGAAT
  • ID
    MGI:701060
  • Product Size
    125
  • Other IDs
    131905 (NCBI UniSTS)
    D9Mit342 (BROAD)
  • Note
    MIT assay: MTH2135
Genes
D9Mit342 DNA Segment, Chr 9 Massachusetts Institute of Technology 342
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit342 a 96bp SPRET/EiJ
b 110bp LP/J
c 124bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
d 126bp B6.Cg-Lepob/+, C57BL/6J
e 128bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory