About   Help   FAQ
D9Mit341 Primer Detail
Primers
  • Name
    D9Mit341
  • Primer 1 Sequence
    TCTGTTTTGTATGCGCATATCC
  • Primer 2 Sequence
    ACCTGGTCTTCACATTCACTCA
  • ID
    MGI:701059
  • Product Size
    115
  • Other IDs
    131904 (NCBI UniSTS)
    D9Mit341 (BROAD)
  • Note
    MIT assay: MTH2582
Genes
D9Mit341 DNA Segment, Chr 9 Massachusetts Institute of Technology 341
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit341 a 98bp LP/J
b 100bp SPRET/EiJ
c 120bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
d 124bp DBA/2J, NOD/MrkTac, NON/ShiLt
e 126bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/31/2020
MGI 6.15
The Jackson Laboratory