About   Help   FAQ
D1Mit33 Primer Detail
Primers
  • Name
    D1Mit33
  • Primer 1 Sequence
    GGATGGACATGCCCAGAG
  • Primer 2 Sequence
    TCCCATGAAATGAGGTTTTTG
  • ID
    MGI:700987
  • Product Size
    100
  • Other IDs
    D1Mit33 (BROAD)
  • Note
    MIT assay: B192
    Additional information: MIT STS Marker Data Files
Genes
D1Mit33 DNA segment, Chr 1, Massachusetts Institute of Technology 33
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit33 b 0.100kb B10.BR-H2k, B10.D2-H2d, BALB.K-H2k, C57BL/6
c 0.124kb BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D1Mit33 c 94bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit33 a 94bp AKR/J, C3H/HeJ
b 96bp LP/J
c 100bp A/J, C57BL/6J, NON/ShiLt
d 102bp B6.Cg-Lepob/+
e 104bp NOD/MrkTac
f 108bp SPRET/EiJ
g 114bp CAST/EiJ
h 122bp DBA/2J
i 124bp BALB/cJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D1Mit33 c larger C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit33 c 121bp CBA/CaOlaHsd
s 120bp SWR/OlaHsd
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory