About   Help   FAQ
D1Mit33 Primer Detail
Primers
  • Name
    D1Mit33
  • Primer 1 Sequence
    GGATGGACATGCCCAGAG
  • Primer 2 Sequence
    TCCCATGAAATGAGGTTTTTG
  • ID
    MGI:700987
  • Product Size
    100
  • Other IDs
    116260 (NCBI UniSTS)
    D1Mit33 (BROAD)
  • Note
    MIT assay: B192
Genes
D1Mit33 DNA segment, Chr 1, Massachusetts Institute of Technology 33
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit33 b 0.100kb B10.BR-H2k, B10.D2-H2d, BALB.K-H2k, C57BL/6
c 0.124kb BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D1Mit33 c 94bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit33 a 94bp AKR/J, C3H/HeJ
b 96bp LP/J
c 100bp A/J, C57BL/6J, NON/ShiLt
d 102bp B6.Cg-Lepob/+
e 104bp NOD/MrkTac
f 108bp SPRET/EiJ
g 114bp CAST/EiJ
h 122bp DBA/2J
i 124bp BALB/cJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D1Mit33 c larger C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit33 c 121bp CBA/CaOlaHsd
s 120bp SWR/OlaHsd
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/30/2020
MGI 6.15
The Jackson Laboratory