About   Help   FAQ
DXMit127 Primer Detail
Primers
  • Name
    DXMit127
  • Primer 1 Sequence
    GACAGACAGACAGACAGACAGACA
  • Primer 2 Sequence
    CCCTTACCTCAACTTCTTTTTAATG
  • ID
    MGI:700735
  • Product Size
    145
  • Other IDs
    132016 (NCBI UniSTS)
    DXMit127 (BROAD)
  • Note
    MIT assay: MT2403
Genes
DXMit127 DNA segment, Chr X, Massachusetts Institute of Technology 127
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit127 a 141bp A/J, BALB/cJ, C3H/HeJ
b 143bp SPRET/EiJ
c 145bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
d 153bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit127 c 143bp CBA/CaOlaHsd
s 139bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory