About   Help   FAQ
D19Mit9 Primer Detail
Primers
  • Name
    D19Mit9
  • Primer 1 Sequence
    CCGTCTGTATAGTTCCTTTGCC
  • Primer 2 Sequence
    CCCTTGTGAGTGCCTGAATT
  • ID
    MGI:700609
  • Product Size
    121
  • Other IDs
    128427 (NCBI UniSTS)
    D19Mit9 (BROAD)
  • Note
    MIT assay: A882
Genes
D19Mit9 DNA segment, Chr 19, Massachusetts Institute of Technology 9
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit9 a 112bp SPRET/EiJ
b 120bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 124bp B6.Cg-Lepob/+, C57BL/6J
d 138bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/04/2020
MGI 6.14
The Jackson Laboratory