About   Help   FAQ
D3Mit215 Primer Detail
Primers
  • Name
    D3Mit215
  • Primer 1 Sequence
    TAAACATCTAGAAGATGCTGCAGG
  • Primer 2 Sequence
    CTGCATGGCCAGGACTAGTT
  • ID
    MGI:700575
  • Product Size
    143
  • Other IDs
    116290 (NCBI UniSTS)
    D3Mit215 (BROAD)
  • Note
    MIT assay: D1276
Genes
D3Mit215 DNA segment, Chr 3, Massachusetts Institute of Technology 215
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit215 a 128bp CAST/EiJ, SPRET/EiJ
b 148bp B6.Cg-Lepob/+, NOD/MrkTac
c 154bp DBA/2J, LP/J
d 156bp AKR/J, C57BL/6J, NON/ShiLt
e 162bp C3H/HeJ
f 164bp A/J, BALB/cJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit215 c 204bp CBA/CaOlaHsd
s 196bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/07/2020
MGI 6.14
The Jackson Laboratory