About   Help   FAQ
DXMit209 Primer Detail
Primers
  • Name
    DXMit209
  • Primer 1 Sequence
    TTTCCAAGGAGTCCTGGTTC
  • Primer 2 Sequence
    TCCAAAAAGACTTTGACTAACATCA
  • ID
    MGI:700437
  • Product Size
    121
  • Other IDs
    132097 (NCBI UniSTS)
    DXMit209 (BROAD)
  • Note
    MIT assay: MTH2538
Genes
DXMit209 DNA Segment, Chr X Massachusetts Institute of Technology 209
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit209 a 113bp CAST/EiJ
b 121bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 141bp SPRET/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory