D11Mit38 Primer Detail MGI Mouse MGI:700259

D11Mit38 Primer Detail

Name

D11Mit38
Primer 1 Sequence

CCACTATATCCTTAAAGACACGGG
Primer 2 Sequence

TCTGAACCACAAATGTAAACAAGG
ID

MGI:700259
Product Size

138
Note

MIT assay: D576

D11Mit38

DNA segment, Chr 11, Massachusetts Institute of Technology 38

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit38	b	smaller	C57BL/6J
	D11Mit38	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit38	a	76bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	104bp	A/J
	c	112bp	AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	d	128bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer & Copyright Notice Send questions and comments to User Support.	last database update 05/10/2022 MGI 6.19