D11Mit38 Primer Detail MGI Mouse MGI:700259

D11Mit38 Primer Detail

Name

D11Mit38
Primer 1 Sequence

CCACTATATCCTTAAAGACACGGG
Primer 2 Sequence

TCTGAACCACAAATGTAAACAAGG
ID

MGI:700259
Product Size

138
Note

MIT assay: D576

D11Mit38

DNA segment, Chr 11, Massachusetts Institute of Technology 38

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit38	b	smaller	C57BL/6J
	D11Mit38	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit38	a	76bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	104bp	A/J
	c	112bp	AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	d	128bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/25/2025 MGI 6.24