About   Help   FAQ
D1Mit425 Primer Detail
Primers
  • Name
    D1Mit425
  • Primer 1 Sequence
    CAAAAAAACAACACATTTTACTTTCA
  • Primer 2 Sequence
    ACTTTGTATTTCACATGATGTCCTG
  • ID
    MGI:700217
  • Product Size
    121
  • Other IDs
    D1Mit425 (BROAD)
  • Note
    MIT assay: MTH770
    Additional information: MIT STS Marker Data Files
Genes
D1Mit425 DNA segment, Chr 1, Massachusetts Institute of Technology 425
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit425 a 119bp LP/J, SPRET/EiJ
b 121bp B6.Cg-Lepob/+, C57BL/6J
c 125bp CAST/EiJ, NOD/MrkTac
d 153bp DBA/2J, NON/ShiLt
e 157bp A/J, AKR/J, BALB/cJ, C3H/HeJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit425 c 144bp CBA/CaOlaHsd
s 152bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory