About   Help   FAQ
Myh14-pE, Myh14-pF Primer Detail
Primers
  • Name
    Myh14-pE, Myh14-pF
  • Primer 1 Sequence
    GAGCTCGAGGACACTCTGGATT
  • Primer 2 Sequence
    TTTCTTCAGCTCTGTCACCTCC
  • ID
    MGI:6741090
Genes
Myh14 myosin, heavy polypeptide 14
Expression
  • Assay Results
    4
References
J:308323 Schliffka MF, et al., Multiscale analysis of single and double maternal-zygotic Myh9 and Myh10 mutants during mouse preimplantation development. Elife. 2021 Apr 19;10

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory