About   Help   FAQ
Brm-pE, Brm-pF Primer Detail
Primers
  • Name
    Brm-pE, Brm-pF
  • Primer 1 Sequence
    GCATCGCTCATAGGATACAAGAAC
  • Primer 2 Sequence
    TGAGTAAGCGAAGTGCTTTCAGTT
  • ID
    MGI:6739871
Genes
Smarca2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Expression
  • Assay Results
    8
References
J:293793 Basta JM, et al., The core SWI/SNF catalytic subunit Brg1 regulates nephron progenitor cell proliferation and differentiation. Dev Biol. 2020 Aug 15;464(2):176-187

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory