About   Help   FAQ
Taf4b-pA, Taf4b-pB Primer Detail
Primers
  • Name
    Taf4b-pA, Taf4b-pB
  • Primer 1 Sequence
    CAGACAGCCAAAGTCAAGCA
  • Primer 2 Sequence
    TGGAGGTCACATGATTCACAC
  • ID
    MGI:6716364
Genes
Taf4b TATA-box binding protein associated factor 4b
Expression
  • Assay Results
    2
References
J:126326 Olive V, et al., PU.1 (Sfpi1), a pleiotropic regulator expressed from the first embryonic stages with a crucial function in germinal progenitors. Development. 2007 Nov;134(21):3815-25

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory