About   Help   FAQ
Epo-pC, Epo-pD Primer Detail
Primers
  • Name
    Epo-pC, Epo-pD
  • Primer 1 Sequence
    AAAGAATGGAGGTGAGTTGC
  • Primer 2 Sequence
    ACCCACCAACCTCTAAGAAC
  • ID
    MGI:6539
Genes
Epo erythropoietin
Polymorphisms
J:29702 Santos J, et al., Cytogenet Cell Genet. 1995;71(3):223-4
Endonuclease Gene Allele Fragments Strains
Epo b 116bp C57BL/6J, CAST/EiJ, M. m. domesticus, MOLF/EiJ
c 120bp CZECHII, RF/J
s 124bp SPRET/EiJ
J:31797 Santos J, et al., Oncogene. 1996 Feb 1;12(3):669-76
Endonuclease Gene Allele Fragments Strains
Epo b smaller C57BL/6J
r larger RF/J
References
J:29702 Santos J, et al., Eight new polymorphic microsatellites in mouse gene loci. Cytogenet Cell Genet. 1995;71(3):223-4
J:31797 Santos J, et al., Allelic losses on chromosome 4 suggest the existence of a candidate tumor suppressor gene region of about 0.6 cM in gamma-radiation-induced mouse primary thymic lymphomas. Oncogene. 1996 Feb 1;12(3):669-76

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/13/2019
MGI 6.14
The Jackson Laboratory