About   Help   FAQ
Lmod3-pA, Lmod3-pB Primer Detail
Primers
  • Name
    Lmod3-pA, Lmod3-pB
  • Primer 1 Sequence
    GATACGGATCCATGGAAGTCATGGCCCCTGACC
  • Primer 2 Sequence
    GATACAAGCTTTCAATGTTGTTCAGGTTGAGTTCCTTCATGTC
  • ID
    MGI:6510562
Genes
Lmod3 leiomodin 3 (fetal)
Expression
  • Assay Results
    14
References
J:181518 Nanda V, et al., Leiomodin 1, a new serum response factor-dependent target gene expressed preferentially in differentiated smooth muscle cells. J Biol Chem. 2012 Jan 20;287(4):2459-67

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/10/2022
MGI 6.19
The Jackson Laboratory