About   Help   FAQ
Camk1-pA, Camk1-pB Primer Detail
Primers
  • Name
    Camk1-pA, Camk1-pB
  • Primer 1 Sequence
    AAGCAGGCGGAAGACATTAGG
  • Primer 2 Sequence
    AGTTTCTGAGTCCTCTTGTCCT
  • ID
    MGI:6473358
  • Product Size
    104bp
Genes
Camk1 calcium/calmodulin-dependent protein kinase I
Expression
  • Assay Results
    4
References
J:286828 Jiang D, et al., Spatiotemporal gene expression patterns reveal molecular relatedness between retinal laminae. J Comp Neurol. 2020 Apr 1;528(5):729-755

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/10/2022
MGI 6.19
The Jackson Laboratory