About   Help   FAQ
Ap4e1-pA, Ap4e1-pB Primer Detail
Primers
  • Name
    Ap4e1-pA, Ap4e1-pB
  • Primer 1 Sequence
    GGAACTGAGTAGTCTGAAGGCA
  • Primer 2 Sequence
    ACCAAAAGAAGCATCGTATCCAA
  • ID
    MGI:6473354
  • Product Size
    118bp
Genes
Ap4e1 adaptor-related protein complex AP-4, epsilon 1
Expression
  • Assay Results
    4
References
J:286828 Jiang D, et al., Spatiotemporal gene expression patterns reveal molecular relatedness between retinal laminae. J Comp Neurol. 2020 Apr 1;528(5):729-755

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory