About   Help   FAQ
Atp2b4-pA, Atp2b4-pB Primer Detail
Primers
  • Name
    Atp2b4-pA, Atp2b4-pB
  • Primer 1 Sequence
    CTGACCATGGAGCAGTGGAT
  • Primer 2 Sequence
    GGAACTTCAGAGACTTGGTAGG
  • ID
    MGI:6456743
Genes
Atp2b4 ATPase, Ca++ transporting, plasma membrane 4
Expression
  • Assay Results
    2
References
J:229890 Ang SY, et al., KMT2D regulates specific programs in heart development via histone H3 lysine 4 di-methylation. Development. 2016 Mar 1;143(5):810-21

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/09/2022
MGI 6.21
The Jackson Laboratory