About   Help   FAQ
Tnfr1-pA, Tnfr1-pB Primer Detail
Primers
  • Name
    Tnfr1-pA, Tnfr1-pB
  • Primer 1 Sequence
    GAGCCACCAGAGACCAAGAA
  • Primer 2 Sequence
    GCCTTAGAGGTAGCAACAAA
  • ID
    MGI:6452
Genes
Tnfrsf1a tumor necrosis factor receptor superfamily, member 1a
Polymorphisms
J:12703 Takao S, et al., Int Immunol. 1993 Jul;5(7):775-82
Endonuclease Gene Allele Fragments Strains
Tnfrsf1a a 171bp AKR, BALB/c, C3H/HeJ, DBA/1, DBA/2, MRL, MRL-Faslpr, NOD, NON, NZW, P/J, SJL
b 193bp BXSB, C57BL/6, CBA, NZB, PL/J, SM/J
c 197bp M. m. musculus, SWR
m 173bp M. m. domesticus poschiavinus
s 149bp M. spretus
References
J:12703 Takao S, et al., Mouse tumor necrosis factor receptor type I: genomic structure, polymorphism, and identification of regulatory regions. Int Immunol. 1993 Jul;5(7):775-82

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/06/2021
MGI 6.16
The Jackson Laboratory