About   Help   FAQ
Glp1r-pA, Glp1r-pB Primer Detail
Primers
  • Name
    Glp1r-pA, Glp1r-pB
  • Primer 1 Sequence
    GGTGGCCATCCCAGGTGGGAG
  • Primer 2 Sequence
    ACATGTGTCTGTGGTCCCAGGAGGC
  • ID
    MGI:6451
Genes
Glp1r glucagon-like peptide 1 receptor
Polymorphisms
J:24382 Kershaw EE, et al., Mamm Genome. 1995 Apr;6(4):301-3
Endonuclease Gene Allele Fragments Strains
Glp1r b 165bp C57BLKS/J, DBA/2J
c 210bp CAST/EiJ
d 175bp C57BL/6J, DW/Pas, MA/MyJ, SM/Ckc, SM/J
References
J:24382 Kershaw EE, et al., Localization of a (CA)n repeat in glucagon-like peptide-1 receptor gene (Glp1r) to proximal mouse chromosome 17 and its linkage to other markers. Mamm Genome. 1995 Apr;6(4):301-3

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory