About   Help   FAQ
Taf4b_for, Taf4b_rev Primer Detail
Primers
  • Name
    Taf4b_for, Taf4b_rev
  • Primer 1 Sequence
    CAGCCAAGAGTCGCTCCAAT
  • Primer 2 Sequence
    GATCTGGGCAAGCTCCAACT
  • ID
    MGI:6406320
Genes
Taf4b TATA-box binding protein associated factor 4b
Expression
  • Assay Results
    2
References
J:245730 Bardot P, et al., The TAF10-containing TFIID and SAGA transcriptional complexes are dispensable for early somitogenesis in the mouse embryo. Development. 2017 Oct 15;144(20):3808-3818

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory