About   Help   FAQ
Aldh1b1-pC, Aldh1b1-pD Primer Detail
Primers
  • Name
    Aldh1b1-pC, Aldh1b1-pD
  • Primer 1 Sequence
    AGCCTCTGTTCAAGTTCAAG
  • Primer 2 Sequence
    CCTTAAAGCCTCCGAATGG
  • ID
    MGI:6405155
Genes
Aldh1b1 aldehyde dehydrogenase 1 family, member B1
Expression
  • Assay Results
    3
References
J:192460 Ioannou M, et al., ALDH1B1 is a potential stem/progenitor marker for multiple pancreas progenitor pools. Dev Biol. 2013 Feb 1;374(1):153-63

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory