About   Help   FAQ
Megf6-pA, Megf6-pB Primer Detail
Primers
  • Name
    Megf6-pA, Megf6-pB
  • Primer 1 Sequence
    ATGTGGATGAATGTCGAT
  • Primer 2 Sequence
    CCCAAGGCACATTCGTCCAC
  • ID
    MGI:6343395
Genes
Megf6 multiple EGF-like-domains 6
Expression
  • Assay Results
    6
References
J:271659 Wang Y, et al., Generation and characterization of Megf6 null and Cre knock-in alleles. Genesis. 2019 Feb;57(2):e23262

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory