About   Help   FAQ
p5717, p6210 Primer Detail
Primers
  • Name
    p5717, p6210
  • Primer 1 Sequence
    CCAAGAGAGGCGAGCCGGCG
  • Primer 2 Sequence
    AGGCGGAGCTGCCTCCGAGC
  • ID
    MGI:6342777
Genes
Hivep3 human immunodeficiency virus type I enhancer binding protein 3
Expression
  • Assay Results
    6
References
J:77246 Hicar MD, et al., Embryonic expression and regulation of the large zinc finger protein KRC. Genesis. 2002 May;33(1):8-20

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/22/2020
MGI 6.16
The Jackson Laboratory