About   Help   FAQ
72MMANF Primer Detail
Primers
  • Name
    72MMANF
  • Primer 1 Sequence
    AGAATAAACTTCAGCACCAAG
  • Primer 2 Sequence
    ATTTTGAGGACTATGACGTGA
  • ID
    MGI:6332
  • Product Size
    172bp
  • Synonyms
    72.MMANF
Genes
Nppa natriuretic peptide type A
Polymorphisms
J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.
Endonuclease Gene Allele Fragments Strains
Nppa a present B6.PL-Thy1a, C57BL/6J, C57BL/10-H2g7, SPR
b absent NOD, NON
J:20039 Fiedorek FT Jr, et al., Mamm Genome. 1994 Aug;5(8):479-85
Notes: Electrophoretic variants distinguishing the two strains were identified using single stranded conformation polymorphic analysis.
Endonuclease Gene Allele Fragments Strains
Nppa b not given BKS.D-Dock7m
c not given CZECHII
References
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82
J:20039 Fiedorek FT Jr, et al., Mapping of PCR-based markers for mouse chromosome 4 on a backcross penetrant for the misty (m) mutation. Mamm Genome. 1994 Aug;5(8):479-85

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory