Igh-C-pA, Igh-C-pB Primer Detail MGI Mouse MGI:63

Igh-C-pA, Igh-C-pB Primer Detail

Name

Igh-C-pA, Igh-C-pB
Primer 1 Sequence

TAGAGACCATTACACCTAGATTGGAAGACT
Primer 2 Sequence

CTATTCTCTATGTCCCTATTCTGTATTCTG
ID

MGI:63
Product Size

250bp
Synonyms

GA1, GA2

Igh-C

immunoglobulin heavy chain constant region

J:10595 Hanzlik AJ, et al., Genomics. 1990 Jul;7(3):389-93

Gene	Allele	Fragments	Strains
Igh-C	a	not given	A/J, DBA/2J
	b	240bp	BALB/cHuCol-Dnah11^iv, C3H/HeJ, C57BL/6J, C57BL/6J-Dnah11^iv, PL/J, SJL/J, SWR/J, SWV
	c	270bp	129P3/J, AKR/J, BALB/cByJ, C57L/J, C58/J, CAST/EiJ, MEV/1TyJ, NZB/BlNJ

J:3224 de Meeus A, et al., Mamm Genome. 1992;3(11):637-43

Notes: Genomic DNAs from the indicated strains were amplified via PCR, electrophoresed on a 2% low melting/0.5% agarose gel and visualized with ethidium bromide.

Endonuclease	Gene	Allele	Fragments	Strains
	Igh-C	a	not given	(SI/Col x M. spretus)F1 x SI/Col or SI/Col x M. m. musculus)F1 x SI/Col
	Igh-C	m	not given	MAI

J:10595 Hanzlik AJ, et al., The murine situs inversus viscerum (iv) gene responsible for visceral asymmetry is linked tightly to the Igh-C cluster on chromosome 12. Genomics. 1990 Jul;7(3):389-93

J:3224 de Meeus A, et al., A detailed linkage map of subtelomeric murine chromosome 12 region including the situs inversus mutation locus IV. Mamm Genome. 1992;3(11):637-43

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23