About   Help   FAQ
Chd8-pC, Chd8-pD Primer Detail
Primers
  • Name
    Chd8-pC, Chd8-pD
  • Primer 1 Sequence
    CAGAGGAGGAGGGTGAAAAGAAAC
  • Primer 2 Sequence
    GAGTTGTCAGACGATGTGTTACGC
  • ID
    MGI:6287757
  • Region Covered
    exon 3-4
Genes
Chd8 chromodomain helicase DNA binding protein 8
Expression
  • Assay Results
    4
References
J:261980 Suetterlin P, et al., Altered Neocortical Gene Expression, Brain Overgrowth and Functional Over-Connectivity in Chd8 Haploinsufficient Mice. Cereb Cortex. 2018 Jun 1;28(6):2192-2206

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory