About   Help   FAQ
Mum2-pA, Mum2-pB Primer Detail
Primers
  • Name
    Mum2-pA, Mum2-pB
  • Primer 1 Sequence
    CCGATGACTGTCCACAATCTG
  • Primer 2 Sequence
    TCAGCCAGCTCTGGCAGAGAAG
  • ID
    MGI:6280384
Genes
Trappc1 trafficking protein particle complex 1
Expression
  • Assay Results
    8
References
J:74152 Yamaza H, et al., Detection of differentially expressed genes in the early developmental stage of the mouse mandible. Int J Dev Biol. 2001 Jun;45(4):675-80

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory