About   Help   FAQ
Otogelin-pA, Otogelin-pB Primer Detail
Primers
  • Name
    Otogelin-pA, Otogelin-pB
  • Primer 1 Sequence
    CGTTGCCAGTTGGTGTATAATGT
  • Primer 2 Sequence
    GAAAAGTAGTAGTACAGGCCGTC
  • ID
    MGI:6275095
Genes
Otog otogelin
Expression
  • Assay Results
    4
References
J:263439 Deans MR, et al., Mammalian Otolin: a multimeric glycoprotein specific to the inner ear that interacts with otoconial matrix protein Otoconin-90 and Cerebellin-1. PLoS One. 2010 Sep 15;5(9):e12765

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory