About   Help   FAQ
Trip6-pC, Trip6-pD Primer Detail
Primers
  • Name
    Trip6-pC, Trip6-pD
  • Primer 1 Sequence
    GCTGTTACAAGTGTGAGGAGTGT
  • Primer 2 Sequence
    TGGTGACAGTGGCTGAGAG
  • ID
    MGI:6202602
Genes
Trip6 thyroid hormone receptor interactor 6
Expression
  • Assay Results
    4
References
J:264256 Bernardo AS, et al., Mammalian embryo comparison identifies novel pluripotency genes associated with the naive or primed state. Biol Open. 2018 Aug 17;7(8)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory