About   Help   FAQ
Spic-pA, Spic-pB Primer Detail
Primers
  • Name
    Spic-pA, Spic-pB
  • Primer 1 Sequence
    TGGAATGTCACCCACAGAGA
  • Primer 2 Sequence
    CTGTACGGATTGGTGGAAGC
  • ID
    MGI:6202593
Genes
Spic Spi-C transcription factor (Spi-1/PU.1 related)
Expression
  • Assay Results
    4
References
J:264256 Bernardo AS, et al., Mammalian embryo comparison identifies novel pluripotency genes associated with the naive or primed state. Biol Open. 2018 Aug 17;7(8):bio033282

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/10/2022
MGI 6.19
The Jackson Laboratory