About   Help   FAQ
Large2-pA, Large2-pB Primer Detail
Primers
  • Name
    Large2-pA, Large2-pB
  • Primer 1 Sequence
    CGAGAGCTGCTCACTCTGAT
  • Primer 2 Sequence
    GGCATCCAAAGAGCTCTCTT
  • ID
    MGI:6200727
Genes
Large2 LARGE xylosyl- and glucuronyltransferase 2
Expression
  • Assay Results
    2
References
J:215959 Yagi H, et al., AGO61-dependent GlcNAc modification primes the formation of functional glycans on alpha-dystroglycan. Sci Rep. 2013;3:3288

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/13/2022
MGI 6.21
The Jackson Laboratory