About   Help   FAQ
Cyp2j9-pA, Cyp2j9-pB Primer Detail
Primers
  • Name
    Cyp2j9-pA, Cyp2j9-pB
  • Primer 1 Sequence
    CAACCTAACTGCACTGCACAG
  • Primer 2 Sequence
    GGCTTTCTACTTACTGAACCC
  • ID
    MGI:6196502
Genes
Cyp2j9 cytochrome P450, family 2, subfamily j, polypeptide 9
Expression
  • Assay Results
    2
References
J:158229 Baragatti B, et al., EDHF function in the ductus arteriosus: evidence against involvement of epoxyeicosatrienoic acids and 12S-hydroxyeicosatetraenoic acid. Am J Physiol Heart Circ Physiol. 2009 Dec;297(6):H2161-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory