About   Help   FAQ
Igfn1_riboprobe Probe Detail
Nucleotide
Probe/Clone
  • Name
    Igfn1_riboprobe
  • Sequence Type
    cDNA
  • ID
    MGI:6175324
  • Note
    This probe was generated by the Allen Institute for Brain Science. Copyright 2004 Allen Institute for Brain Science. Allen Mouse Brain Atlas. Available from: http://mouse.brain-map.org/. Copyright 2008 Allen Institute for Brain Science. Allen Developing Mouse Brain Atlas. Available from: http://developingmouse.brain-map.org. The probe was generated using PCR; its predicted amplicon based on the genome assembly at the time is:
    CAGGCACCAGGTTCTATCTACCTACAGGAGAATGTGCCTGGGACAGTGACGGTCCAGTGG
    GAACCCTCTCCGGATGAGGCTCAGGGCATCCCCTTGCATTACACAGTGCTGATGCGGTCC
    TCATCTCACCGATCCTGGCACGAGGTGGCCGACCATGTCCGTACCAACCGCTTTACCCTC
    CTAGGGGTCCTCCCTGGCCATGAGTACCACTTTCGGGTGCTGGCCAAGAATGAGCTGGGG
    GTCAGCAAACCTTCAGACACCAGCCAACCCTGGTGTATCCCCAGGCAGAGAGACAGGTTC
    ACAGTGAAGTCTCCGACATACCAGGATCCTGACCTGAGCCAGAAGCCCCGCTTCCTGGTG
    GGTCTGCGGGCTCACCTTCTGCCCCAGGGCTGTGAGTGCCGCATGACGTGTGCCGTGCAG
    GGCTCACCCCAGCCTCATGTCACCTGGTTCAAGAATGACCAAAGCTTGGACAGAAACCCT
    GCGGTGTACAGTACTGACTTGCTGGGTGTGTGCTCCCTCGTCATCCCCAGCGTGTCCCTT
    AAGGACAGTGGTGAATACAAGGCTGTGGCCAAGAACCCACTGGGACAAGCTGTCAGCACA
    GCCACCCTCATTGTCACAGAATACG
  • Synonyms
    RP_050524_03_B01, RP_060620_02_D05, RP_080326_03_G10
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal
  • Tissue
    brain
Genes
Igfn1 immunoglobulin-like and fibronectin type III domain containing 1
Expression
  • Assay Results
    7
References
J:262123 Allen Institute for Brain Science, Allen Brain Atlas: mouse riboprobes. Allen Institute. 2004;
J:215487 Thompson CL, et al., A high-resolution spatiotemporal atlas of gene expression of the developing mouse brain. Neuron. 2014 Jul 16;83(2):309-23

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory