About   Help   FAQ
Trip6-pA, Trip6-pB Primer Detail
Primers
  • Name
    Trip6-pA, Trip6-pB
  • Primer 1 Sequence
    GAAGCCCAGTGGAGGTGCTG
  • Primer 2 Sequence
    ACTCCAGAAGGTCCCTCCGG
  • ID
    MGI:6162572
Genes
Trip6 thyroid hormone receptor interactor 6
Expression
  • Assay Results
    13
References
J:215602 Lai YJ, et al., TRIP6 regulates neural stem cell maintenance in the postnatal mammalian subventricular zone. Dev Dyn. 2014 Sep;243(9):1130-42

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory