About   Help   FAQ
Syde1-pA, Syde1-pB Primer Detail
Primers
  • Name
    Syde1-pA, Syde1-pB
  • Primer 1 Sequence
    GGTACCTCAGCGATGGTGAT
  • Primer 2 Sequence
    CTACCCCATCCACTTGGAGA
  • ID
    MGI:6154905
Genes
Syde1 synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Expression
  • Assay Results
    8
References
J:241798 Lo HF, et al., Association of dysfunctional synapse defective 1 (SYDE1) with restricted fetal growth - SYDE1 regulates placental cell migration and invasion. J Pathol. 2017 Feb;241(3):324-336

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory