About   Help   FAQ
Fzd10-pE, Fzd10-pF Primer Detail
Primers
  • Name
    Fzd10-pE, Fzd10-pF
  • Primer 1 Sequence
    TGTCCGGTTGCTACACCATGGGCT
  • Primer 2 Sequence
    GCCAGGAACCAGGTGAGG
  • ID
    MGI:6100966
Genes
Fzd10 frizzled class receptor 10
Expression
  • Assay Results
    10
References
J:198258 Noguchi TK, et al., Novel cell surface genes expressed in the stomach primordium during gastrointestinal morphogenesis of mouse embryos. Gene Expr Patterns. 2012 Mar-Apr;12(3-4):154-63

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/09/2022
MGI 6.21
The Jackson Laboratory