About   Help   FAQ
Chd8-pA, Chd8-pB Primer Detail
Primers
  • Name
    Chd8-pA, Chd8-pB
  • Primer 1 Sequence
    AGCCTTTCAATCCAGACTACG
  • Primer 2 Sequence
    CATCCTCTTTTAGCTCCCACG
  • ID
    MGI:5912299
Genes
Chd8 chromodomain helicase DNA binding protein 8
Expression
  • Assay Results
    6
References
J:238209 Durak O, et al., Chd8 mediates cortical neurogenesis via transcriptional regulation of cell cycle and Wnt signaling. Nat Neurosci. 2016 Nov;19(11):1477-1488

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory