About   Help   FAQ
Dpy19l2-pA, Dpy19l2-pB Primer Detail
Primers
  • Name
    Dpy19l2-pA, Dpy19l2-pB
  • Primer 1 Sequence
    ACAAAACCTGGTTGCAGCAT
  • Primer 2 Sequence
    CCTCTTTGCTCCACACAGAA
  • ID
    MGI:5910653
Genes
Dpy19l2 dpy-19-like 2 (C. elegans)
Expression
  • Assay Results
    2
References
J:181003 Watanabe K, et al., Dpy19l1, a multi-transmembrane protein, regulates the radial migration of glutamatergic neurons in the developing cerebral cortex. Development. 2011 Nov;138(22):4979-90

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory