About   Help   FAQ
Ki67-pA, Ki67-pB Primer Detail
Primers
  • Name
    Ki67-pA, Ki67-pB
  • Primer 1 Sequence
    ATTCGTATCCAGCTGCCTGTAGTGTC
  • Primer 2 Sequence
    GGCTTGCTTCCATCCTCATGATTTCC
  • ID
    MGI:5901922
Genes
Mki67 antigen identified by monoclonal antibody Ki 67
Expression
  • Assay Results
    5
References
J:239792 Hong KY, et al., Perilipin+ embryonic preadipocytes actively proliferate along growing vasculatures for adipose expansion. Development. 2015 Aug 01;142(15):2623-32

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory