About   Help   FAQ
mESyt1.FOR, mESyt1.REV Primer Detail
Primers
  • Name
    mESyt1.FOR, mESyt1.REV
  • Primer 1 Sequence
    TGGGATCCTGGTATCTCAGC
  • Primer 2 Sequence
    CTGGGAGATCACGTCCATTT
  • ID
    MGI:5817187
Genes
Esyt1 extended synaptotagmin-like protein 1
Expression
  • Assay Results
    42
References
J:232605 Herdman C, et al., Loss of Extended Synaptotagmins ESyt2 and ESyt3 does not affect mouse development or viability, but in vitro cell migration and survival under stress are affected. Cell Cycle. 2014;13(16):2616-25
J:236096 Tremblay MG, et al., Loss of all 3 Extended Synaptotagmins does not affect normal mouse development, viability or fertility. Cell Cycle. 2016 Sep;15(17):2360-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory