About   Help   FAQ
Arhgef3 cDNA Probe Detail
Nucleotide
Probe/Clone
  • Name
    Arhgef3 cDNA
  • Sequence Type
    cDNA
  • ID
    MGI:5811323
  • Region Covered
    portion of open reading frame
  • Parent Clone
  • Note
    This cDNA was generated by PCR using the following primers: AGACCTTCGATGTGTGTGTC and GGAAAACATGGAGTTTCACA. T7 promoter sequence was added to the 3' primer to allow for T7-mediated transcription, enabling direct generation of the antisense probe.
Source
  • Library
    Riken mouse cDNA library 12-000 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal adult
  • Sex
    Male
  • Tissue
    lung
Genes
Arhgef3 Rho guanine nucleotide exchange factor (GEF) 3
Expression
  • Assay Results
    28
References
J:226028 Lewandowski JP, et al., Spatiotemporal regulation of GLI target genes in the mammalian limb bud. Dev Biol. 2015 Oct 1;406(1):92-103

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory