About   Help   FAQ
BCO1-pA, BCO1-pB Primer Detail
Primers
  • Name
    BCO1-pA, BCO1-pB
  • Primer 1 Sequence
    GAGCAAGTACAACCATTGGT
  • Primer 2 Sequence
    AACTCAGACACCACGATTC
  • ID
    MGI:5774506
Genes
Bco1 beta-carotene oxygenase 1
Expression
  • Assay Results
    2
References
J:230265 Kim YK, et al., Tissue- and sex-specific effects of beta-carotene 15,15' oxygenase (BCO1) on retinoid and lipid metabolism in adult and developing mice. Arch Biochem Biophys. 2015 Apr 15;572:11-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/18/2020
MGI 6.14
The Jackson Laboratory