About   Help   FAQ
CMP-U5, CMP-L5 Primer Detail
Primers
  • Name
    CMP-U5, CMP-L5
  • Primer 1 Sequence
    ATGGCCGGAGCCAGGACTACA
  • Primer 2 Sequence
    GCCGCTTACTCACAGCTTCCA
  • ID
    MGI:5707285
Genes
Matn1 matrilin 1, cartilage matrix protein
Expression
  • Assay Results
    1
References
J:32849 Aszodi A, et al., Cloning, sequencing and expression analysis of mouse cartilage matrix protein cDNA. Eur J Biochem. 1996 Mar 15;236(3):970-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory