About   Help   FAQ
D115 Primer Detail
Primers
  • Name
    D115
  • Primer 1 Sequence
    CGGTGACGAAGCTTCTGAG
  • Primer 2 Sequence
    CTTTGAATATGAACTCTCACCTTCC
  • ID
    MGI:569
Genes
D2Mit29 DNA segment, Chr 2, Massachusetts Institute of Technology 29
Svs4 seminal vesicle secretory protein 4
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D2Mit29 e 115bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
f 120bp CAST/EiJ
s 110bp SPRET/EiJ
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
11/22/2022
MGI 6.22
The Jackson Laboratory