About   Help   FAQ
Tead2-pA, Tead2-pB Primer Detail
Primers
  • Name
    Tead2-pA, Tead2-pB
  • Primer 1 Sequence
    TGAGCAGCCAGTATGAGAGC
  • Primer 2 Sequence
    CAGCAGACGGTACACAAAGC
  • ID
    MGI:5484865
Genes
Tead2 TEA domain family member 2
Expression
  • Assay Results
    8
References
J:130047 Nishioka N, et al., Tead4 is required for specification of trophectoderm in pre-implantation mouse embryos. Mech Dev. 2008 Mar-Apr;125(3-4):270-83

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/04/2020
MGI 6.14
The Jackson Laboratory