About   Help   FAQ
CMOI-Fw, CMOI-Rev1 Primer Detail
Primers
  • Name
    CMOI-Fw, CMOI-Rev1
  • Primer 1 Sequence
    GAGCAAGTACAACCATTGGT
  • Primer 2 Sequence
    AACTCAGACACCAGGATTC
  • ID
    MGI:5471399
Genes
Bco1 beta-carotene oxygenase 1
Expression
  • Assay Results
    9
References
J:172777 Kim YK, et al., beta-Carotene and its cleavage enzyme beta-carotene-15,15'-oxygenase (CMOI) affect retinoid metabolism in developing tissues. FASEB J. 2011 May;25(5):1641-52

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/11/2020
MGI 6.14
The Jackson Laboratory