About   Help   FAQ
D2D5FW, DOlr1RW Primer Detail
Primers
  • Name
    D2D5FW, DOlr1RW
  • Primer 1 Sequence
    TGCGAATGACGAGCCTGAT
  • Primer 2 Sequence
    TTATGCCAGAGCCAGTCTTGTG
  • ID
    MGI:5427901
Genes
Olr1 oxidized low density lipoprotein (lectin-like) receptor 1
Expression
  • Assay Results
    13
References
J:179076 Vecchione L, et al., Functional characterization and expression analysis of novel alternative splicing isoforms of Olr1 gene during mouse embryogenesis. Gene. 2012 Jan 1;491(1):5-12

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory